Genotyping

Overview: During the first period of this lab students isolate genomic DNA from their cheek cells. Students also examine cheek cells and stain nuclei. During the second lab period, students amplify specific segments of their DNA using the polymerase chain reaction (PCR). During the third lab period, students electrophoretically analyze the results of the amplification on agarose gels.

Week Three

Today you will load your PCR product into a well on the horizontal gel that you poured the first week and turn the current on... your DNA will travel towards the positive pole (anode) and the smaller pieces will travel faster than the larger pieces, thereby separating into bands if there is more than one size of PCR product.

Review your notes from last time... where did you leave off? What information are you missing that the instructor must give you?

1. Make sure the tube(s) containing the PCR products you are responsible for are thawed by holding them tightly in your fingers for a minute or so.
   
   
2. Place your tiny PCR tubes into a large microfuge tube and quickly pulse spin the tubes to bring down any condensate from the lid of the tube.
   
   
3. Add 5 uL of loading dye to each of your PCR product tubes and mix gently but thoroughly by pipetting. The loading dye also contains glycerol to increase the density of the sample so that your sample falls through the buffer to the bottom of the well.
   
   
4. Copy down the gel loading sequence illustrated on the board. Note which lane(s) you are responsible for.
   
   
5. Using a clean tip for each sample, load 20 ul into the well of the correct lane based on the directions on the board.

Repeat experiment using in-silico pcr!

Thursday Section - Get a laptop from the cart, turn it on, and hook it up to the ethernet if there is no wireless.

Friday Section - Grab your things and follow the instructor to S-119. When you are there, log in to a computer work station.

Scientists often plan PCR experiments and then try them "in silico" before going through a whole lab procedure. Because you are a human, you will use the primers we added to your DNA two weeks ago to "amplify" DNA from the Human Genome Database.

Now let's have a look at the structure of the DNA where the 300 bp insert is located.

Here are the primers we used to amplify your DNA.

Left Primer (aka forward)  5'-AACTGGGAAAATTTGAAGAGAAAGT-3'

Right Primer (aka reverse) 5'-ATGGATGTAGTTGGTGTCATGGTCA-3'
reverse complement            TGACCATGACACCAACTACATCCAT

National Center for Biotechnology Information

Search the Human gene database using nucleotide-nucleotide BLAST for matches to the reverse complement of the right primer. Write down the accession number for the best match. Now do the same for the left primer. Write down the accession number and relevant information from the best match for both primers. Copy that DNA sequence into notepad and save it on your desktop or a folder you can find again.

Go to the UCSC Human Genome Browser and let's repeat our experiment with their 'in silico' pcr program. Which chromosome do you amplify DNA from? What is the size of your pcr product? Did it contain the insert?

How would you check your pcr product to see if it is the correct piece of DNA?

When the gel has finished running and the current has been turned off it will need to be viewed and photographed on the UV light box in order to visualize the ethidium bromide stained DNA bands.

• Record whether you are homozygous for the insertion, heterozygous for the insertion, or homozygous for no insertion. Do the same for any other sample you may be responsible for.

• Take a digital photo of the labeled gel so that Kibak can share the photo with the correct students.

1. After recording the data in your lab book, add your data to the table on the board.
2. After everyone has added their data to the table on the board, copy it into your lab book.
3. How many individuals had the insert in at least one of their chromosomes? What was the frequency of each allele in this population sample?

For your write-up please use the following format:

Background Section including amplification of DNA copy number using Polymerase Chain Reaction, Alu repeats in human biology, and the Human Genome Project... about a paragraph or two for each of those three topics. Finish with a paragraph on this specific PCR experiment.  What are the two alleles you are trying to detect? (PowerPoint presentation on Alu) (PCR animation)

Materials & Methods including primer sequences, wet lab pcr, and 'in silico' pcr

Results

• Photos of gels with lanes you were responsible for with captions identifying the lanes.
• Table of results from the board today including the frequency of each allele.
• Accession numbers of top hits for BLAST search of the left and right primers.
• Sequence and chromosome number of PCR product from the 'in silico' PCR.

Short Discussion Discuss the PCR product of the 'in silico' experiment. Did it have the insert? What implications does that have for the Human Genome Project?

References:

Recent Insertion of an Alu Element Within a Polymorphic Human-Specific Alu Insertion
David Comas, Ste´phanie Plaza, Francesc Calafell, Antti Sajantila, and Jaume Bertranpetit
Mol Biol Evol. 2001 Jan;18(1):85-88. PDF document HERE

A transpositionally and transcriptionally competent Alu subfamily
A G Matera, U Hellmann, and C W Schmid
Mol Cell Biol. 1990 October; 10 (10): 5424–5432. PDF document HERE