Genotyping

Overview: During the first period of this lab students isolate genomic DNA from their cheek cells. Students also examine cheek cells and stain nuclei. During the second lab period, students amplify specific segments of their DNA using the polymerase chain reaction (PCR). During the third lab period, students electrophoretically analyze the results of the amplification on agarose gels. During the fourth lab period, students repeat their experiment using the in-silico PCR program of the UCSC Human Genome Project.

Week Four

Scientists often plan PCR experiments and then try them "in silico" before going through a whole lab proceedure. Because you are a human, you will use the primers we added to your DNA two weeks ago to "amplify" DNA from the Human Genome Database.

If you haven't already done so, first look at your gel and record whether you are homozygous for the insertion, heterozygous for the insertion, or homozygous for no insertion. Do the same for any other sample you may be responsible for.

1. After recording the data in your lab book, add your data to the table on the board.
2. After everyone has added their data to the table on the board, copy it into your lab book.
3. How many individuals had the insert in at least one of their chromosomes? What was the frequency of each allele in this population sample?

Now let's have a look at the structure of the DNA where the 300 bp insert is located.

Here are the primers we used to amplify your DNA.

Left Primer (aka forward)  5'-AACTGGGAAAATTTGAAGAGAAAGT-3'

Right Primer (aka reverse) 5'-ATGGATGTAGTTGGTGTCATGGTCA-3'
reverse complement            TGACCATGACACCAACTACATCCAT

National Center for Biotechnology Information

Search the Human gene database using nucleotide-nucleotide BLAST for matches to the reverse complement of the right primer. Write down the accession number for the best match. Now do the same for the left primer. Write down the accession number and relevant information from the best match for both primers. Copy that DNA sequence into notepad and save it on your desktop or a folder you can find again.

Go to the UCSC Human Genome Browser and let's repeat our experiment with their 'in silico' pcr program. Which chromosome do you amplify DNA from? What is the size of your pcr product? Did it contain the insert?

How would you check your pcr product to see if it is the correct piece of DNA?

For your write-up please use the following format:

Background Section including amplification of DNA copy number using Polymerase Chain Reaction, Alu repeats in human biology, and the Human Genome Project... about a paragraph or two for each of those three topics. Finish with a paragraph on this specific PCR experiment.  What are the two alleles you are trying to detect? (PowerPoint presentation on Alu) (PCR animation)

Materials & Methods including primer sequences, wet lab pcr, and 'in silico' pcr

Results

• Photos of gels with lanes you were responsible for with captions identifying the lanes.
• Table of results from the board today including the frequency of each allele.
• Accession numbers of top hits for BLAST search of the left and right primers.
• Sequence and chromosome number of PCR product from the 'in silico' PCR.

Short Discussion Discuss the PCR product of the 'in silico' experiment. Did it have the insert? What implications does that have for the Human Genome Project?

References:

Recent Insertion of an Alu Element Within a Polymorphic Human-Specific Alu Insertion
David Comas, Ste´phanie Plaza, Francesc Calafell, Antti Sajantila, and Jaume Bertranpetit
Mol Biol Evol. 2001 Jan;18(1):85-88. PDF document HERE

A transpositionally and transcriptionally competent Alu subfamily
A G Matera, U Hellmann, and C W Schmid
Mol Cell Biol. 1990 October; 10 (10): 5424–5432. PDF document HERE