Working with DNA Sequences

 

A.  Start by viewing the chromatograph and extracting your sequence:

1.      You will be working with files named “SB3-T7”. 

a.       Open Chromas.exe

b.      To open your file chose File à Open à *.ab1

c.       Scroll along the sequence to the end

i.        Ques: What happens to the size of the peaks? Why are there more “N’s” here?

d.      Try changing the height of the peaks (Y axis) or the spacing between peaks (X axis)

i.         Go to Options à Y Zoom or Options à X Zoom

2.      Now export the sequence as text.

a.       Choose Edit à Copy Sequence à Fasta Format

b.      To save your file chose File à Export

c.       Name the file “SB3-T7seq”, then click Save

3.      Open the fasta file in Word

a.       Start à Programs à Microsoft Word

b.      Choose File à Open

c.       Select your fasta file

4.      Separate or delete the poorly sequenced region at the end of your sequence (Hint: Pick a spot just before 4 or more N’s in a row).

B. Remove vector and primer sequences from novel insert sequence:

1.      Search for the two EcoRI restriction sites in your sequence

a.       Make sure your cursor is at the beginning of your sequence

b.      Go to Edit à Find

c.       Type the nucleotide sequence you are searching for (GAATTC for EcoRI)

d.      Click Find Next (to find the first restriction site)

2.      Identify the beginning of the cloned insert sequence

a.       Use your vector sequence and reading away from the restriction site (left to right)

i.         GATT

b.      Separate (with returns) or delete the vector sequence (all sequence to the left).

3.      Repeat to identify the other end of your cloned insert.

a.       Make sure your cursor is at the beginning of your cloned insert.

b.      Go to Edit à Find; Make sure “GAATTC” is in the window; Click Find Next

c.       Identify the 3’ (far right) end of the cloned insert sequence

i.         Use your vector sequence and reading away from the restriction site (right to left NOW -  TGATCACTAA). 

ii.       Separate or delete the vector sequence (all sequence to the RIGHT).

4.      Ques: What determines which end of the vector will be at the beginning of the sequence?

5.      Search for your two primer sequences using the Find function as explained above.

a.       The forward primer is:

i.         ccaaacccgtcatctactag

b.      The reverse complement of the reverse primer is:

i.         GGTACGCTTATATTCAAGAAGAGCAT

c.       Ques: Is it equally possible that the positions of the forward and reverse primer will be switched?

6.      Separate or remove the primer sequences from the rest of your sequence.  This now leaves you with the NOVEL sequence of your insert.

a.       Ques: Why do we call it the insert?

7.      Save this sequence.

a.       Remove all non-insert sequence

b.      Top line should read”>SB3insert” (no spaces, no punctuation), Return

c.       Go to File à Save As

d.      Name your file “SB3 insert” and click Save

e.       Leave this file open

C. Check that you have the right thing:

1.      BLAST against the DNA data base

2.      Go to http://teach.mlml.calstate.edu/

a.       Click on MSRSI link

b.      Click on Marine Biotechnology and Bioinformatics link

c.       Click on Course resources Link

d.      Scroll down and clink of “BLAST” in blue on right

e.       Under “Nucleotide”, select “Nucleotide-nucleotide BLAST (blastn)”

3.      Go to your open “SB3 insert” file

a.       Choose Edit à Select All

b.      Choose Edit à Copy

4.      Go to open web page and paste into the “Search” box at the top

a.       Click Blast

b.      Ques; What database are we searching right now?

5.      On the new page that you see click Format

a.       Wait for result. The page will automatically update until it is done.

i.         Look at the distribution diagram

ii.       Look at the sequence list

iii.      Scroll down and view the first alignment

iv.     Scroll to the end and view the last alignment

b.      Where are the M. trossulus sequences??

D. Align your insert sequence and make a phylogenetic tree:

1.      Find and open the “to_align” file.  This file contains other Mytilus sequences from the database in fasta format

a.       Paste your sequence at the bottom

i.         Place the cursor at the bottom and go to Edit à Paste

b.      File à Save

2.      Open clustalx.exe

a.       File à Load Sequences

b.      Alignment à Do Complete Alignment,  Click ALIGN

c.       Your sequence is too long

i.         Go back to the “to_align”  file

1.      Remove sequence to the left of “GCCCATA”

2.      Remove sequence to the right of “ATGTTTAC”

3.      Save

ii.       Ques: Why are other sequences in the database shorter?

d.      Repeat loading and aligning of sequence.  New alignment files will overwrite the old.

e.       Make a Tree file

i.         Trees à Draw N-J Tree, this will make a *.ph file

3.      Open drawtree.exe

a.       Enter name of file “to_align.ph”

b.      Change settings as follows

i.         L” for Angel of labels

ii.       R” for Radial

c.       Y” to accept

d.      Tree Preview screen will appear behind your active screen

i.         Click on this screen and pull the lower right corner to enlarge

Congratulations! You did it.

The last BIG question: From this tree, what can you say about the sex and species of the original animal that produced this PCR product?